WebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, …
CHST10 antibody (12013-1-AP) Proteintech - ptglab
WebRabbit polyclonal antibody raised against synthetic peptide of CHST10.IgGy Antibody Selector – Quickly search hundreds of thousands of antibodies available for … WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate … grand theft auto computer game free
Fawn Creek Township Map - Locality - Kansas, United States
WebCarbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR): Novus Biologicals View Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR). Validated Applications: IHC, IHC-P. Validated Species: Human. Skip to main content Support: 1-888-506-6887 Items in Cart (0) [X] … WebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution; Synonyms: Anti-Carbohydrate sulfotransferase 10,Anti-HNK-1 sulfotransferase,Anti-HNK-1ST,Anti-HNK1ST,Anti-huHNK-1ST; find Sigma-Aldrich-HPA012884 MSDS, related peer … WebHNK-1ST/CHST10 antibodies are validated with different applications, which are IHC-P. HNK-1ST/CHST10 cDNA Clone (13) HNK-1ST/CHST10 cDNA clones are full length sequence confirmed and expression validated. There are 13 kinds of tags for each HNK-1ST/CHST10 of different species, especially GFP tag, OFP tag, FLAG tag and so on. … grand theft auto coming to switch